Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CD0680 gene

Properties
Regulog: CD0683 - Clostridia-2
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Firmicutes
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium difficile 630
Position: -37
Score: 6.33563
Sequence: TTATGCATACGTATTCTGAA
Locus tag: CD0680
Name: CD0680
Funciton: Hypothetical protein
Locus tag: CD0681
Name: CD0681
Funciton: Predicted transporter, MFS superfamily
Locus tag: CD0682
Name: CD0682
Funciton: Putative sugar-sodium symporter
Locus tag: CD0683
Name: CD0683
Funciton: Predicted transcriptional regulator, LacI family
CD0680-CD0681-CD0682-CD0683 -37 6.3 TTATGCATACGTATTCTGAA CD0680
© 2009-2020 RegPrecise