Orthologous regulated operons containing Patl_0290 gene
| Regulog: | Patl_0292 - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -78
Score: 7.44869 Sequence: CAACTAAACCGGTTTAGTAG
Locus tag: Patl_0291
Name: Patl_0291 Funciton: Putative racemase
Locus tag: Patl_0290
Name: Patl_0290 Funciton: Putative oxidoreductase
Locus tag: Patl_0289
Name: Patl_0289 Funciton: sodium-solute symporter, putative
Locus tag: Patl_0288
Name: Patl_0288 Funciton: Hypothetical protein |
||||
| Patl_0291-Patl_0290-Patl_0289-Patl_0288 | -78 | 7.4 | CAACTAAACCGGTTTAGTAG | Patl_0291 |