Orthologous regulated operons containing Csal_3211 gene
| Regulog: | Csal_3216 - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -126
Score: 6.77048 Sequence: ATCTGGTAGCGCTACCAATA
Position: -84
Score: 7.29043 Sequence: TTTTGGTAGCGCTACCAAAA
Locus tag: Csal_3215
Name: Csal_3215 Funciton: Predicted sugar carboxylase
Locus tag: Csal_3214
Name: Csal_3214 Funciton: TRAP transporterm, DctP subunit
Locus tag: Csal_3213
Name: Csal_3213 Funciton: TRAP transporter, DctQ system
Locus tag: Csal_3212
Name: Csal_3212 Funciton: TRAP transporter, DctM subunit
Locus tag: Csal_3211
Name: Csal_3211 Funciton: Predicted NAD-dependent sugar epimerase/dehydratase |
||||
| Csal_3215-Csal_3214-Csal_3213-Csal_3212-Csal_3211 | -126 | 6.8 | ATCTGGTAGCGCTACCAATA | Csal_3215 |
| -84 | 7.3 | TTTTGGTAGCGCTACCAAAA | ||