Orthologous regulated operons containing manP gene
| Regulog: | ManR2 - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -228
Score: 6.04161 Sequence: TACTGTAATCGATAACAAAA
Position: -133
Score: 6.74508 Sequence: AATTGTAATCGATTACAATT
Locus tag: Patl_0120
Name: mnnA1 Funciton: Alpha-1,2-mannosidase
Locus tag: Patl_0119
Name: manP Funciton: Predicted mannose transporter, GGP family
Locus tag: Patl_0118
Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
Locus tag: Patl_0117
Name: mnnA1 Funciton: Alpha-1,2-mannosidase
Locus tag: Patl_0116
Name: mnnA1 Funciton: Alpha-1,2-mannosidase |
||||
| mnnA1-manP-manI-mnnA1-mnnA1 | -228 | 6 | TACTGTAATCGATAACAAAA | Patl_0120 |
| -133 | 6.7 | AATTGTAATCGATTACAATT | ||