Orthologous regulated operons containing manP gene

Properties
Regulog:	ManR2 - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -228 Score: 6.04161 Sequence: TACTGTAATCGATAACAAAA Position: -133 Score: 6.74508 Sequence: AATTGTAATCGATTACAATT Locus tag: Patl_0120 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: Patl_0119 Name: manP Funciton: Predicted mannose transporter, GGP family Locus tag: Patl_0118 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7) Locus tag: Patl_0117 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: Patl_0116 Name: mnnA1 Funciton: Alpha-1,2-mannosidase
mnnA1-manP-manI-mnnA1-mnnA1	-228	6	TACTGTAATCGATAACAAAA	Patl_0120
	-133	6.7	AATTGTAATCGATTACAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --