Orthologous regulated operons containing ptsR gene
Regulog: | PtsR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Enterobacter sp. 638 | ||||
Position: -75
Score: 7.02065 Sequence: TAAGTAGAACGTTCTACTAA
Position: -62
Score: 6.45344 Sequence: CTACTAAAACGTTCTACTTA
Locus tag: Ent638_0984
Name: ptsS Funciton: Sugar-specific PTS, IICBA component (EC 2.7.1.69)
Locus tag: Ent638_0983
Name: ptsR Funciton: Transcriptional regulator of uncharcterized sugar PTS system, LacI family |
||||
ptsS-ptsR | -75 | 7 | TAAGTAGAACGTTCTACTAA | Ent638_0984 |
-62 | 6.5 | CTACTAAAACGTTCTACTTA |