Orthologous regulated operons containing ptsS gene
| Regulog: | PtsR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -75
Score: 7.02065 Sequence: TAAGTAGAACGTTCTACTAA
Position: -62
Score: 6.45344 Sequence: CTACTAAAACGTTCTACTTA
Locus tag: Ent638_0984
Name: ptsS Funciton: Sugar-specific PTS, IICBA component (EC 2.7.1.69)
Locus tag: Ent638_0983
Name: ptsR Funciton: Transcriptional regulator of uncharcterized sugar PTS system, LacI family |
||||
| ptsS-ptsR | -75 | 7 | TAAGTAGAACGTTCTACTAA | Ent638_0984 |
| -62 | 6.5 | CTACTAAAACGTTCTACTTA | ||