Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omp(Man) gene

Properties
Regulog: ManR2 - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -165
Score: 6.78347
Sequence: AATTGTAATCGATTACATTT
Locus tag: Patl_0122
Name: omp(Man)
Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
Locus tag: Patl_0123
Name: mnnA2
Funciton: Alpha-1,2-mannosidase
omp(Man)-mnnA2 -165 6.8 AATTGTAATCGATTACATTT Patl_0122