Orthologous regulated operons containing PF10091 gene
| Regulog: | BglR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Yersinia pestis KIM | ||||
|
Position: -62
Score: 6.72892 Sequence: TTATAGAAACGTTTCTATTG
Locus tag: y3570
Name: PF10091 Funciton: Six-hairpin glycosidase-like protein |
||||
| PF10091 | -62 | 6.7 | TTATAGAAACGTTTCTATTG | y3570 |