Orthologous regulated operons containing y3563 gene
Regulog: | BglR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Yersinia pestis KIM | ||||
Position: -34
Score: 6.58587 Sequence: CTAGTGAAACGTTTCTATTG
Locus tag: y3569
Name: bglD Funciton: Predicted beta-glucoside ABC transport system, ATP-binding subunit
Locus tag: y3568
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: y3567
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: y3566
Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein
Locus tag: y3565
Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1
Locus tag: y3564
Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
Locus tag: y3563
Name: y3563 Funciton: Putative exported protein precursor
Locus tag: y3562
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
bglD-cbpA-bglR-bglA-bglB-bglC-y3563-bglX | -34 | 6.6 | CTAGTGAAACGTTTCTATTG | y3569 |