Orthologous regulated operons containing EF1237 gene
Regulog: | BglR - Enterococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Enterococcus faecalis V583 | ||||
Position: -217
Score: 6.83644 Sequence: TTGGTGAAACGTTTCTATAA
Position: -39
Score: 6.83644 Sequence: TTGTAGAAACGTTTCACTAA
Locus tag: EF1232
Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1
Locus tag: EF1233
Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2
Locus tag: EF1234
Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein
Locus tag: EF1235
Name: EF1235 Funciton: Hypothetical protein
Locus tag: EF1236
Name: EF1236 Funciton: Putative acetyl xylan esterase
Locus tag: EF1237
Name: EF1237 Funciton: Conserved hypothetical protein
Locus tag: EF1238
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: EF1239
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: EF1240
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family |
||||
bglB-bglC-bglA-EF1235-EF1236-EF1237-bglX-cbpA-bglR | -217 | 6.8 | TTGGTGAAACGTTTCTATAA | EF1232 |
-39 | 6.8 | TTGTAGAAACGTTTCACTAA |