Orthologous regulated operons containing ABC1167 gene
Regulog: | ABC1167 - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus clausii KSM-K16 | ||||
Position: -71
Score: 6.73701 Sequence: CATTGCATACGTATGCAAAT
Position: -35
Score: 6.78073 Sequence: TTTTGAATACGTATGCAAGA
Locus tag: ABC1168
Name: ABC1168 Funciton: Putative dehydrogenase
Locus tag: ABC1167
Name: ABC1167 Funciton: Predicted transcriptional regulator, LacI family
Locus tag: ABC1166
Name: gntT Funciton: Gluconate transporter |
||||
ABC1168-ABC1167-gntT | -71 | 6.7 | CATTGCATACGTATGCAAAT | ABC1168 |
-35 | 6.8 | TTTTGAATACGTATGCAAGA |