Orthologous regulated operons containing iolZ gene
Regulog: | IolR - Oceanospirillales/Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Inositol utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Hahella chejuensis KCTC 2396 | ||||
Position: -76
Score: 6.12174 Sequence: TTTTGCACACGGGTGCAATG
Locus tag: HCH_03296
Name: null Funciton: Predicted inositol ABC transporter, substrate-binding protein
Locus tag: HCH_03297
Name: iolW Funciton: Predicted inositol ABC transporter, permease protein 1
Locus tag: HCH_03298
Name: iolX Funciton: Predicted inositol ABC transporter, permease protein 2
Locus tag: HCH_03299
Name: iolY Funciton: Predicted inositol ABC transporter, ATP-binding protein
Locus tag: HCH_03300
Name: iolZ Funciton: Predicted metal-dependent hydrolase
Locus tag: HCH_03301
Name: suhB Funciton: Inositol-1-monophosphatase (EC 3.1.3.25)
Locus tag: HCH_03302
Name: iolR Funciton: Inositol utilization transcriptional regulator IolR, LacI family |
||||
HCH_03296-iolW-iolX-iolY-iolZ-suhB-iolR | -76 | 6.1 | TTTTGCACACGGGTGCAATG | HCH_03296 |