Orthologous regulated operons containing phnT gene
| Regulog: | PhnR1 - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | 2-aminoethylphosphonate utilization |
| Effector: | 2-aminoethylphosphonate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Serratia proteamaculans 568 | ||||
|
Position: -49
Score: 6.14112 Sequence: TTGCTGGACTAGTCCAGCCA
Locus tag: Spro_4488
Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: Spro_4487
Name: Spro_4487 Funciton: type I phosphodiesterase
Locus tag: Spro_4486
Name: phnU Funciton: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: Spro_4485
Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Locus tag: Spro_4484
Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
||||
| phnS-Spro_4487-phnU-phnV-phnT | -49 | 6.1 | TTGCTGGACTAGTCCAGCCA | Spro_4488 |