Orthologous regulated operons containing phnU gene

Properties
Regulog:	PhnR1 - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Phylum:	Proteobacteria/Gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Serratia proteamaculans 568
Position: -49 Score: 6.14112 Sequence: TTGCTGGACTAGTCCAGCCA Locus tag: Spro_4488 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: Spro_4487 Name: Spro_4487 Funciton: type I phosphodiesterase Locus tag: Spro_4486 Name: phnU Funciton: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: Spro_4485 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: Spro_4484 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnS-Spro_4487-phnU-phnV-phnT	-49	6.1	TTGCTGGACTAGTCCAGCCA	Spro_4488

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --