Orthologous regulated operons containing phnF gene
| Regulog: | PhnF - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylibium petroleiphilum PM1 | ||||
|
Position: -28
Score: 4.37072 Sequence: CCCAGATATCTAGACATCTGGA
Locus tag: Mpe_B0420
Name: phnF Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
Locus tag: Mpe_B0421
Name: phnD Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Locus tag: Mpe_B0422
Name: phnC Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) |
||||
| phnF-phnD-phnC | -28 | 4.4 | CCCAGATATCTAGACATCTGGA | Mpe_B0420 |