Orthologous regulated operons containing PF01370 gene
| Regulog: | SoxR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseobacter sp. MED193 | ||||
|
Position: -57
Score: 6.23756 Sequence: AGCTAAAGTTAGCTTTAGAT
Locus tag: MED193_22126
Name: PF01370 Funciton: NAD-dependent epimerase/dehydratase |
||||
| PF01370 | -57 | 6.2 | AGCTAAAGTTAGCTTTAGAT | MED193_22126 |