Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF00106 gene

Properties
Regulog: SoxR - Rhizobiales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Alpha
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Xanthobacter autotrophicus Py2
Position: -145
Score: 5.63459
Sequence: ACCTAAACCATACTCGAGGT
Locus tag: Xaut_1054
Name: null
Funciton: short-chain dehydrogenase/reductase SDR
Xaut_1054 -145 5.6 ACCTAAACCATACTCGAGGT Xaut_1054
© 2009-2020 RegPrecise