Orthologous regulated operons containing PF07690 gene
| Regulog: | SoxR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Delftia acidovorans SPH-1 | ||||
|
Position: -45
Score: 5.61912 Sequence: ATCTCAACCGCACTTGAGGT
Locus tag: Daci_3895
Name: PF07690 Funciton: Permease of the major facilitator superfamily |
||||
| PF07690 | -45 | 5.6 | ATCTCAACCGCACTTGAGGT | Daci_3895 |