Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF07690 gene

Properties
Regulog: SoxR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -45
Score: 5.61912
Sequence: ATCTCAACCGCACTTGAGGT
Locus tag: Daci_3895
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF07690 -45 5.6 ATCTCAACCGCACTTGAGGT Daci_3895
© 2009-2020 RegPrecise