Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mexF gene

Properties
Regulog: SoxR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -185
Score: 5.93405
Sequence: ACCTCAACAATGGTTGAGGT
Locus tag: Aave_1362
Name: mexE
Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1363
Name: mexF
Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1364
Name: oprN
Funciton: RND transporter, outer membrane protein
mexE-mexF-oprN -185 5.9 ACCTCAACAATGGTTGAGGT Aave_1362
© 2009-2020 RegPrecise