Orthologous regulated operons containing mexF gene
| Regulog: | SoxR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||||
|
Position: -185
Score: 5.93405 Sequence: ACCTCAACAATGGTTGAGGT
Locus tag: Aave_1362
Name: mexE Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1363
Name: mexF Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1364
Name: oprN Funciton: RND transporter, outer membrane protein |
||||
| mexE-mexF-oprN | -185 | 5.9 | ACCTCAACAATGGTTGAGGT | Aave_1362 |