Orthologous regulated operons containing mexE gene
Regulog: | SoxR - Comamonadaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Superoxide stress response |
Effector: | Paraquat |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Acidovorax avenae subsp. citrulli AAC00-1 | ||||
Position: -185
Score: 5.93405 Sequence: ACCTCAACAATGGTTGAGGT
Locus tag: Aave_1362
Name: mexE Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1363
Name: mexF Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1364
Name: oprN Funciton: RND transporter, outer membrane protein |
||||
mexE-mexF-oprN | -185 | 5.9 | ACCTCAACAATGGTTGAGGT | Aave_1362 |