Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Vapar_4430 gene

Properties
Regulog: SoxR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Variovorax paradoxus S110
Position: -35
Score: 6.20869
Sequence: ACCTCAAGTTAGGTTGAGGC
Locus tag: Vapar_4430
Name: null
Funciton: hypothetical protein
Vapar_4430 -35 6.2 ACCTCAAGTTAGGTTGAGGC Vapar_4430
© 2009-2020 RegPrecise