Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF03992 gene

Properties
Regulog: SoxR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Polaromonas sp. JS666
Position: -83
Score: 6.67963
Sequence: ACCTCAACTTTACTTGAGGT
Locus tag: Bpro_1374
Name: PF03992
Funciton: Monooxygenase
PF03992 -83 6.7 ACCTCAACTTTACTTGAGGT Bpro_1374