Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF03358 gene

Properties
Regulog: SoxR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas mendocina ymp
Position: -63
Score: 6.61342
Sequence: ACCTTAAGTTAAGTTGAGGT
Locus tag: Pmen_1342
Name: PF03358
Funciton: NADPH-dependent FMN reductase
PF03358 -63 6.6 ACCTTAAGTTAAGTTGAGGT Pmen_1342