Orthologous regulated operons containing opmD gene
| Regulog: | SoxR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -125
Score: 6.87137 Sequence: ACCTCAACTTAACTTGAGGT
Locus tag: PA4205
Name: mexG Funciton: Membrane protein
Locus tag: PA4206
Name: mexH Funciton: RND transporter, membrane fusion protein
Locus tag: PA4207
Name: mexI Funciton: RND transporter, membrane fusion protein
Locus tag: PA4208
Name: opmD Funciton: RND transporter, outer membrane protein |
||||
| mexG-mexH-mexI-opmD | -125 | 6.9 | ACCTCAACTTAACTTGAGGT | PA4205 |