Orthologous regulated operons containing Atu4688 gene

Properties
Regulog:	IdnR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Phylum:	Proteobacteria/Alpha

Built upon 32 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -245 Score: 5.70868 Sequence: CAATGATACCGATAACATGC Position: -83 Score: 6.36887 Sequence: AAATGTTATCGAGAACATTT Locus tag: Atu4687 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: Atu4688 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Atu4689 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Atu4690 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein Locus tag: Atu4691 Name: COG1063 Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Atu4687-Atu4688-Atu4689-Atu4690-COG1063	-245	5.7	CAATGATACCGATAACATGC	Atu4687
	-83	6.4	AAATGTTATCGAGAACATTT
Azorhizobium caulinodans ORS 571
Position: -96 Score: 5.96004 Sequence: TTTTGTTACCGATAACATGC Locus tag: AZC_2614 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: AZC_2615 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: AZC_2616 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: AZC_2617 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: AZC_2618 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein Locus tag: AZC_2619 Name: COG1063 Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
idnO-Atu4687-Atu4688-Atu4689-Atu4690-COG1063	-96	6	TTTTGTTACCGATAACATGC	AZC_2614
Rhizobium sp. NGR234
Position: -217 Score: 6.45754 Sequence: ATTTGTTATCGATAACATCT Locus tag: NGR_b22370 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: NGR_b22360 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: NGR_b22350 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: NGR_b22340 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein
Atu4687-Atu4688-Atu4689-Atu4690	-217	6.5	ATTTGTTATCGATAACATCT	NGR_b22370
Xanthobacter autotrophicus Py2
Position: -83 Score: 5.65488 Sequence: TCATGTTACCGATATCATGA Locus tag: Xaut_2437 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: Xaut_2438 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: Xaut_2439 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Xaut_2440 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Xaut_2441 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein
idnO-Atu4687-Atu4688-Atu4689-Atu4690	-83	5.7	TCATGTTACCGATATCATGA	Xaut_2437