Orthologous regulated operons containing merE gene
| Regulog: | MerR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -9
Score: 6.32826 Sequence: ACTCCGTACATGAGTACGGAAG
Locus tag: ASA_P4G088
Name: merT Funciton: Mercury uptake inner membane protein
Locus tag: ASA_P4G089
Name: merP Funciton: Periplasmic mercury(+2) binding protein
Locus tag: ASA_P4G090
Name: merC Funciton: Mercury uptake inner membane protein
Locus tag: ASA_P4G091
Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: ASA_P4G092
Name: merD Funciton: Mercuric resistance operon coregulator
Locus tag: ASA_P4G093
Name: merE Funciton: Putative mercury resistance protein
Locus tag: ASA_P4G094
Name: PF00563 Funciton: Diguanylate phosphodiesterase, EAL domain |
||||
| merT-merP-merC-merA-merD-merE-PF00563 | -9 | 6.3 | ACTCCGTACATGAGTACGGAAG | ASA_P4G088 |