Orthologous regulated operons containing fba gene
| Regulog: | CceR (GapR) - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism |
| Effector: | 6-phosphogluconate |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -80
Score: 4.80324 Sequence: GCCTGATAGCGCAACCATGA
Locus tag: Jann_1693
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -80 | 4.8 | GCCTGATAGCGCAACCATGA | Jann_1693 |
| Loktanella vestfoldensis SKA53 | ||||
|
Position: -104
Score: 5.27298 Sequence: CGCCGTTTGCGATAACATCC
Position: -83
Score: 5.08957 Sequence: GTCCGTTCGCGCTAACATAT
Locus tag: SKA53_05615
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -104 | 5.3 | CGCCGTTTGCGATAACATCC | SKA53_05615 |
| -83 | 5.1 | GTCCGTTCGCGCTAACATAT | ||
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -100
Score: 5.22854 Sequence: GGGCGTTAGCGCCAACGGGC
Locus tag: OB2597_04490
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -100 | 5.2 | GGGCGTTAGCGCCAACGGGC | OB2597_04490 |
| Oceanicola granulosus HTCC2516 | ||||
|
Position: -82
Score: 4.99268 Sequence: CCCCGGTGGCGCTAACAGGT
Locus tag: OG2516_03238
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -82 | 5 | CCCCGGTGGCGCTAACAGGT | OG2516_03238 |
| Paracoccus denitrificans PD1222 | ||||
|
Position: -74
Score: 4.58911 Sequence: TTCCGTTAGCGCAATCGCGA
Locus tag: Pden_1920
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -74 | 4.6 | TTCCGTTAGCGCAATCGCGA | Pden_1920 |
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -79
Score: 4.86649 Sequence: CCAAGTTAGCGCGAACAACA
Locus tag: RSP_4045
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -79 | 4.9 | CCAAGTTAGCGCGAACAACA | RSP_4045 |
| Rhodobacterales bacterium HTCC2654 | ||||
|
Position: -81
Score: 4.37147 Sequence: ATGCGTTAGCGCGACCAGAA
Locus tag: RB2654_05195
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -81 | 4.4 | ATGCGTTAGCGCGACCAGAA | RB2654_05195 |
| Roseobacter sp. MED193 | ||||
|
Position: -100
Score: 4.73747 Sequence: GCCCGTTAGCGCAAGCGCTT
Locus tag: MED193_20764
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -100 | 4.7 | GCCCGTTAGCGCAAGCGCTT | MED193_20764 |
| Roseovarius nubinhibens ISM | ||||
|
Position: -80
Score: 4.57869 Sequence: AGGCGTTAGCGCCACCAAGA
Locus tag: ISM_04665
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -80 | 4.6 | AGGCGTTAGCGCCACCAAGA | ISM_04665 |
| Roseovarius sp. 217 | ||||
|
Position: -85
Score: 4.66792 Sequence: TTCTGTTAGCGCCACCACGA
Locus tag: ROS217_17772
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -85 | 4.7 | TTCTGTTAGCGCCACCACGA | ROS217_17772 |
| Silicibacter TM1040 | ||||
|
Position: -105
Score: 5.02094 Sequence: GGGCGTTAGCGCAACCATTG
Locus tag: TM1040_1976
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -105 | 5 | GGGCGTTAGCGCAACCATTG | TM1040_1976 |
| Silicibacter pomeroyi DSS-3 | ||||
|
Position: -83
Score: 4.34295 Sequence: GTAGTTGAGCGCTAACATCC
Locus tag: SPO1899
Name: fba Funciton: Fructose-bisphosphate aldolase class I (EC 4.1.2.13) |
||||
| fba | -83 | 4.3 | GTAGTTGAGCGCTAACATCC | SPO1899 |