Orthologous regulated operons containing RHE_PC00150 gene
| Regulog: | KglR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Sinorhizobium meliloti 1021 | ||||
|
Position: -77
Score: 5.88243 Sequence: ATTTTAGATCGATCTAACTG
Locus tag: SMa0079
Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0081
Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0082
Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: SMa0083
Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: SMa0085
Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
Locus tag: SMa0087
Name: null Funciton: hypothetical protein |
||||
| Sma0079-Sma0081-Sma0082-Sma0083-PF00389-SMa0087 | -77 | 5.9 | ATTTTAGATCGATCTAACTG | SMa0079 |