Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RHE_PC00150 gene

Properties
Regulog: KglR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Sinorhizobium meliloti 1021
Position: -77
Score: 5.88243
Sequence: ATTTTAGATCGATCTAACTG
Locus tag: SMa0079
Name: Sma0079
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0081
Name: Sma0081
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0082
Name: Sma0082
Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: SMa0083
Name: Sma0083
Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: SMa0085
Name: PF00389
Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
Locus tag: SMa0087
Name: null
Funciton: hypothetical protein
Sma0079-Sma0081-Sma0082-Sma0083-PF00389-SMa0087 -77 5.9 ATTTTAGATCGATCTAACTG SMa0079
© 2009-2020 RegPrecise