Orthologous regulated operons containing Sma0082 gene

Properties
Regulog:	KglR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -163 Score: 5.57097 Sequence: GTTTTAGATCGGTCTAAAAA Locus tag: AZC_4404 Name: kglR Funciton: Transcriptional regulator, LacI family Locus tag: AZC_4405 Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: AZC_4406 Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: AZC_4407 Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein Locus tag: AZC_4408 Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein Locus tag: AZC_4409 Name: dgoK Funciton: 2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58) Locus tag: AZC_4410 Name: dgoA Funciton: 2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21)
kglR-Sma0079-Sma0081-Sma0082-Sma0083-dgoK-dgoA	-163	5.6	GTTTTAGATCGGTCTAAAAA	AZC_4404
Sinorhizobium meliloti 1021
Position: -77 Score: 5.88243 Sequence: ATTTTAGATCGATCTAACTG Locus tag: SMa0079 Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: SMa0081 Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: SMa0082 Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein Locus tag: SMa0083 Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein Locus tag: SMa0085 Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding Locus tag: SMa0087 Name: null Funciton: hypothetical protein
Sma0079-Sma0081-Sma0082-Sma0083-PF00389-SMa0087	-77	5.9	ATTTTAGATCGATCTAACTG	SMa0079