Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sma0079 gene

Properties
Regulog: KglR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -163
Score: 5.57097
Sequence: GTTTTAGATCGGTCTAAAAA
Locus tag: AZC_4404
Name: kglR
Funciton: Transcriptional regulator, LacI family
Locus tag: AZC_4405
Name: Sma0079
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: AZC_4406
Name: Sma0081
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: AZC_4407
Name: Sma0082
Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: AZC_4408
Name: Sma0083
Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: AZC_4409
Name: dgoK
Funciton: 2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58)
Locus tag: AZC_4410
Name: dgoA
Funciton: 2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21)
kglR-Sma0079-Sma0081-Sma0082-Sma0083-dgoK-dgoA -163 5.6 GTTTTAGATCGGTCTAAAAA AZC_4404
Sinorhizobium meliloti 1021
Position: -77
Score: 5.88243
Sequence: ATTTTAGATCGATCTAACTG
Locus tag: SMa0079
Name: Sma0079
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0081
Name: Sma0081
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: SMa0082
Name: Sma0082
Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: SMa0083
Name: Sma0083
Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: SMa0085
Name: PF00389
Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
Locus tag: SMa0087
Name: null
Funciton: hypothetical protein
Sma0079-Sma0081-Sma0082-Sma0083-PF00389-SMa0087 -77 5.9 ATTTTAGATCGATCTAACTG SMa0079