Orthologous regulated operons containing kglR gene
| Regulog: | KglR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -163
Score: 5.57097 Sequence: GTTTTAGATCGGTCTAAAAA
Locus tag: AZC_4404
Name: kglR Funciton: Transcriptional regulator, LacI family
Locus tag: AZC_4405
Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: AZC_4406
Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: AZC_4407
Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: AZC_4408
Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: AZC_4409
Name: dgoK Funciton: 2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58)
Locus tag: AZC_4410
Name: dgoA Funciton: 2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21) |
||||
| kglR-Sma0079-Sma0081-Sma0082-Sma0083-dgoK-dgoA | -163 | 5.6 | GTTTTAGATCGGTCTAAAAA | AZC_4404 |