Orthologous regulated operons containing Jann_4085 gene

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -93 Score: 5.72872 Sequence: GGGTGCATACGAATGCAAAA Locus tag: Jann_4090 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Jann_4089 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_4088 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_4087 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Jann_4086 Name: null Funciton: hypothetical protein Locus tag: Jann_4085 Name: null Funciton: Cupin 2 protein Locus tag: Jann_4084 Name: null Funciton: acyl transferase
Jann_4090-Jann_4089-Jann_4088-Jann_4087-Jann_4086-Jann_4085-Jann_4084	-93	5.7	GGGTGCATACGAATGCAAAA	Jann_4090

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --