Orthologous regulated operons containing Jann_4089 gene
| Regulog: | Jann_1107 - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -93
Score: 5.72872 Sequence: GGGTGCATACGAATGCAAAA
Locus tag: Jann_4090
Name: null Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: Jann_4089
Name: null Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Jann_4088
Name: null Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Jann_4087
Name: null Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: Jann_4086
Name: null Funciton: hypothetical protein
Locus tag: Jann_4085
Name: null Funciton: Cupin 2 protein
Locus tag: Jann_4084
Name: null Funciton: acyl transferase |
||||
| Jann_4090-Jann_4089-Jann_4088-Jann_4087-Jann_4086-Jann_4085-Jann_4084 | -93 | 5.7 | GGGTGCATACGAATGCAAAA | Jann_4090 |