Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_4084 gene

Properties
Regulog: Jann_1107 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -93
Score: 5.72872
Sequence: GGGTGCATACGAATGCAAAA
Locus tag: Jann_4090
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: Jann_4089
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Jann_4088
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Jann_4087
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: Jann_4086
Name: null
Funciton: hypothetical protein
Locus tag: Jann_4085
Name: null
Funciton: Cupin 2 protein
Locus tag: Jann_4084
Name: null
Funciton: acyl transferase
Jann_4090-Jann_4089-Jann_4088-Jann_4087-Jann_4086-Jann_4085-Jann_4084 -93 5.7 GGGTGCATACGAATGCAAAA Jann_4090