Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_3701 gene

Properties
Regulog: Jann_1107 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -36
Score: 6.36128
Sequence: TCTTGCAAACCTATGCAAAA
Locus tag: Jann_3701
Name: Jann_3701
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: Jann_3700
Name: Jann_3700
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: Jann_3699
Name: Jann_3699
Funciton: Sugar ABC transporter, inner membrane protein
Jann_3701-Jann_3700-Jann_3699 -36 6.4 TCTTGCAAACCTATGCAAAA Jann_3701
Oceanicola granulosus HTCC2516
Position: -50
Score: 4.95742
Sequence: CCTTGCAAGCGCATGCAAGG
Locus tag: OG2516_10551
Name: Jann_2640
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: OG2516_10546
Name: Jann_3701
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: OG2516_10541
Name: Jann_3700
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: OG2516_10536
Name: Jann_3699
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: OG2516_10531
Name: PF03766
Funciton: Protein of unknown function DUF1486
Locus tag: OG2516_10526
Name: PF00815
Funciton: Histidinol dehydrogenase
Locus tag: OG2516_10521
Name: PF07366-3
Funciton: Protein of unknown function DUF1486
Locus tag: OG2516_10516
Name: COG1028
Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: OG2516_10511
Name: Jann_1107
Funciton: Transcriptional regulator, LacI family
Locus tag: OG2516_10506
Name: PF07366-2
Funciton: Protein of unknown function DUF1486
Jann_2640-Jann_3701-Jann_3700-Jann_3699-PF03766-PF00815-PF07366-3-COG1028-Jann_1107-PF07366-2 -50 5 CCTTGCAAGCGCATGCAAGG OG2516_10551