Orthologous regulated operons containing COG1028 gene

Properties
Regulog:	Jann_1107 - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -81 Score: 5.9338 Sequence: TTTTGCAATCGTATGCAGAT Locus tag: Jann_1104 Name: PF00815 Funciton: Histidinol dehydrogenase Locus tag: Jann_1105 Name: PF07366-3 Funciton: Protein of unknown function DUF1486 Locus tag: Jann_1106 Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR Locus tag: Jann_1107 Name: Jann_1107 Funciton: Transcriptional regulator, LacI family Locus tag: Jann_1108 Name: PF07366-2 Funciton: Protein of unknown function DUF1486
PF00815-PF07366-3-COG1028-Jann_1107-PF07366-2	-81	5.9	TTTTGCAATCGTATGCAGAT	Jann_1104
Oceanicola granulosus HTCC2516
Position: -50 Score: 4.95742 Sequence: CCTTGCAAGCGCATGCAAGG Locus tag: OG2516_10551 Name: Jann_2640 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: OG2516_10546 Name: Jann_3701 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: OG2516_10541 Name: Jann_3700 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: OG2516_10536 Name: Jann_3699 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: OG2516_10531 Name: PF03766 Funciton: Protein of unknown function DUF1486 Locus tag: OG2516_10526 Name: PF00815 Funciton: Histidinol dehydrogenase Locus tag: OG2516_10521 Name: PF07366-3 Funciton: Protein of unknown function DUF1486 Locus tag: OG2516_10516 Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR Locus tag: OG2516_10511 Name: Jann_1107 Funciton: Transcriptional regulator, LacI family Locus tag: OG2516_10506 Name: PF07366-2 Funciton: Protein of unknown function DUF1486
Jann_2640-Jann_3701-Jann_3700-Jann_3699-PF03766-PF00815-PF07366-3-COG1028-Jann_1107-PF07366-2	-50	5	CCTTGCAAGCGCATGCAAGG	OG2516_10551