Orthologous regulated operons containing COG1028 gene
| Regulog: | Jann_1107 - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -81
Score: 5.9338 Sequence: TTTTGCAATCGTATGCAGAT
Locus tag: Jann_1104
Name: PF00815 Funciton: Histidinol dehydrogenase
Locus tag: Jann_1105
Name: PF07366-3 Funciton: Protein of unknown function DUF1486
Locus tag: Jann_1106
Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1107
Name: Jann_1107 Funciton: Transcriptional regulator, LacI family
Locus tag: Jann_1108
Name: PF07366-2 Funciton: Protein of unknown function DUF1486 |
||||
| PF00815-PF07366-3-COG1028-Jann_1107-PF07366-2 | -81 | 5.9 | TTTTGCAATCGTATGCAGAT | Jann_1104 |
| Oceanicola granulosus HTCC2516 | ||||
|
Position: -50
Score: 4.95742 Sequence: CCTTGCAAGCGCATGCAAGG
Locus tag: OG2516_10551
Name: Jann_2640 Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: OG2516_10546
Name: Jann_3701 Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: OG2516_10541
Name: Jann_3700 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: OG2516_10536
Name: Jann_3699 Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: OG2516_10531
Name: PF03766 Funciton: Protein of unknown function DUF1486
Locus tag: OG2516_10526
Name: PF00815 Funciton: Histidinol dehydrogenase
Locus tag: OG2516_10521
Name: PF07366-3 Funciton: Protein of unknown function DUF1486
Locus tag: OG2516_10516
Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: OG2516_10511
Name: Jann_1107 Funciton: Transcriptional regulator, LacI family
Locus tag: OG2516_10506
Name: PF07366-2 Funciton: Protein of unknown function DUF1486 |
||||
| Jann_2640-Jann_3701-Jann_3700-Jann_3699-PF03766-PF00815-PF07366-3-COG1028-Jann_1107-PF07366-2 | -50 | 5 | CCTTGCAAGCGCATGCAAGG | OG2516_10551 |