Orthologous regulated operons containing omp(Bgl)1 gene
| Regulog: | BglR1 - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside; Glucose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -98
Score: 6.66168 Sequence: AATTGGAAGCGCTTCCATAG
Locus tag: CC1754
Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides
Locus tag: CC1755
Name: thl1 Funciton: Tryptophan halogenase
Locus tag: CC1756
Name: bglX1 Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: CC1757
Name: GH30 Funciton: Glycosyl hydrolase, family 30 |
||||
| omp(Bgl)1-thl1-bglX1-GH30 | -98 | 6.7 | AATTGGAAGCGCTTCCATAG | CC1754 |
| Caulobacter sp. K31 | ||||
|
Position: -108
Score: 6.85606 Sequence: TGTTGGAAGCGCTTCCAATG
Locus tag: Caul_2063
Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides
Locus tag: Caul_2064
Name: thl1 Funciton: Tryptophan halogenase |
||||
| omp(Bgl)1-thl1 | -108 | 6.9 | TGTTGGAAGCGCTTCCAATG | Caul_2063 |