Orthologous regulated operons containing omp(Bgl)1 gene

Properties
Regulog:	BglR1 - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Phylum:	Proteobacteria/Alpha

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -98 Score: 6.66168 Sequence: AATTGGAAGCGCTTCCATAG Locus tag: CC1754 Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: CC1755 Name: thl1 Funciton: Tryptophan halogenase Locus tag: CC1756 Name: bglX1 Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: CC1757 Name: GH30 Funciton: Glycosyl hydrolase, family 30
omp(Bgl)1-thl1-bglX1-GH30	-98	6.7	AATTGGAAGCGCTTCCATAG	CC1754
Caulobacter sp. K31
Position: -108 Score: 6.85606 Sequence: TGTTGGAAGCGCTTCCAATG Locus tag: Caul_2063 Name: omp(Bgl)1 Funciton: TonB-dependent uoter membrane transporter for beta-glucosides Locus tag: Caul_2064 Name: thl1 Funciton: Tryptophan halogenase
omp(Bgl)1-thl1	-108	6.9	TGTTGGAAGCGCTTCCAATG	Caul_2063

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --