Orthologous regulated operons containing ytrB gene
| Regulog: | YtrA2 - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux; Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | ||||
|
Position: -51
Score: 6.43283 Sequence: GTGTGTATTATATTATATAGTACAGTT
Locus tag: MCCL_0413
Name: ytrA2 Funciton: Transcription regulator, GntR family
Locus tag: MCCL_0414
Name: ytrB Funciton: ABC-type multidrug transporter, ATPase component
Locus tag: MCCL_0415
Name: ytrC/ytrD Funciton: ABC-type multidrug transporter, permease component |
||||
| ytrA2-ytrB-ytrC/ytrD | -51 | 6.4 | GTGTGTATTATATTATATAGTACAGTT | MCCL_0413 |