Orthologous regulated operons containing gntX gene

Properties
Regulog:	GntR - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Phylum:	Proteobacteria/beta

Built upon 28 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -109 Score: 6.07601 Sequence: CTAGGATAGCGCTATCTTGC Locus tag: Aave_2797 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Aave_2796 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Aave_2795 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Aave_2794 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
gntK-gntY-gntZ-gntX	-109	6.1	CTAGGATAGCGCTATCTTGC	Aave_2797
Acidovorax sp. JS42
Position: -180 Score: 6.04656 Sequence: TTAAGATAGCGCTATCTTTC Locus tag: Ajs_2053 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Ajs_2052 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Ajs_2051 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Ajs_2050 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Ajs_2049 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12) Locus tag: Ajs_2048 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK-gntY-gntZ-gntX-edd-eda	-180	6	TTAAGATAGCGCTATCTTTC	Ajs_2053
Comamonas testosteroni KF-1
Position: -147 Score: 6.01302 Sequence: TTATGATAGCGCTATCCGGA Position: -21 Score: 6.34252 Sequence: ATCGGATAGCGCTATCCAAA Locus tag: CtesDRAFT_0561 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: CtesDRAFT_0560 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: CtesDRAFT_0559 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: CtesDRAFT_0558 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: CtesDRAFT_0557 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12) Locus tag: CtesDRAFT_0556 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK-gntY-gntZ-gntX-edd-eda	-147	6	TTATGATAGCGCTATCCGGA	CtesDRAFT_0561
	-21	6.3	ATCGGATAGCGCTATCCAAA
Delftia acidovorans SPH-1
Position: -120 Score: 6.27531 Sequence: TTATGATAGCGCTATCCCAA Locus tag: Daci_3761 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Daci_3762 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Daci_3763 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Daci_3764 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Daci_3765 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12) Locus tag: Daci_3766 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK-gntY-gntZ-gntX-edd-eda	-120	6.3	TTATGATAGCGCTATCCCAA	Daci_3761
Polaromonas naphthalenivorans CJ2
Position: -140 Score: 6.46716 Sequence: ATAGGATAGCGCTATCCCAA Position: -30 Score: 6.10489 Sequence: AACGGATAGCGCTATCCAAG Locus tag: Pnap_0046 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Pnap_0045 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Pnap_0044 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Pnap_0043 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
gntK-gntY-gntZ-gntX	-140	6.5	ATAGGATAGCGCTATCCCAA	Pnap_0046
	-30	6.1	AACGGATAGCGCTATCCAAG