Orthologous regulated operons containing treR gene
| Regulog: | TreR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -94
Score: 6.11775 Sequence: TAATGCAATCGATTGCAAGG
Position: -71
Score: 5.9052 Sequence: TTTTACAATCGATTGCATTG
Locus tag: CPS_0978
Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family |
||||
| treR | -94 | 6.1 | TAATGCAATCGATTGCAAGG | CPS_0978 |
| -71 | 5.9 | TTTTACAATCGATTGCATTG | ||
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -381
Score: 6.41151 Sequence: AAATGCAAACGATTGCAATT
Position: -357
Score: 6.41112 Sequence: TTTTGCAATCGTTTGCATTT
Locus tag: Patl_1823
Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family |
||||
| treR | -381 | 6.4 | AAATGCAAACGATTGCAATT | Patl_1823 |
| -357 | 6.4 | TTTTGCAATCGTTTGCATTT | ||
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -165
Score: 6.41112 Sequence: TTATGCAAACGTTTGCAATT
Locus tag: PTD2_20307
Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family |
||||
| treR | -165 | 6.4 | TTATGCAAACGTTTGCAATT | PTD2_20307 |