Orthologous regulated operons containing treT gene
| Regulog: | TreR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -151
Score: 6.41072 Sequence: TTATGCAATCGTTTGCAAAA
Position: -94
Score: 4.83573 Sequence: ATATGCAATCGATAGTGTTT
Locus tag: CPS_0981
Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily |
||||
| treT | -151 | 6.4 | TTATGCAATCGTTTGCAAAA | CPS_0981 |
| -94 | 4.8 | ATATGCAATCGATAGTGTTT | ||
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -73
Score: 6.21623 Sequence: GAATGCAAACGATTGCATTT
Locus tag: Patl_1824
Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily
Locus tag: Patl_1825
Name: treF Funciton: Trehalase (EC 3.2.1.28) |
||||
| treT-treF | -73 | 6.2 | GAATGCAAACGATTGCATTT | Patl_1824 |
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -113
Score: 6.41151 Sequence: AAATGCAAACGTTTGCATTT
Locus tag: PTD2_20312
Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily
Locus tag: PTD2_20317
Name: treF Funciton: Trehalase (EC 3.2.1.28) |
||||
| treT-treF | -113 | 6.4 | AAATGCAAACGTTTGCATTT | PTD2_20312 |