Orthologous regulated operons containing rhmF gene

Properties
Regulog:	RhmR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose oligosaccharides utilization
Effector:
Phylum:	Chloroflexi

Built upon 1 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -177 Score: 5.6567 Sequence: CATACCGATCGATGCCCAGG Locus tag: Chy400_0391 Name: rhmE Funciton: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component Locus tag: Chy400_0390 Name: rhmF Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component Locus tag: Chy400_0389 Name: rhmG Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component Locus tag: Chy400_0388 Name: rhmA Funciton: alpha-L-rhamnosidase Locus tag: Chy400_0387 Name: GH1 Funciton: glycoside hydrolase family 1
rhmE-rhmF-rhmG-rhmA-GH1	-177	5.7	CATACCGATCGATGCCCAGG	Chy400_0391

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --