Orthologous regulated operons containing rhmE gene
Regulog: | RhmR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Rhamnose oligosaccharides utilization |
Effector: | |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chloroflexus sp. Y-400-fl | ||||
Position: -177
Score: 5.6567 Sequence: CATACCGATCGATGCCCAGG
Locus tag: Chy400_0391
Name: rhmE Funciton: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
Locus tag: Chy400_0390
Name: rhmF Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0389
Name: rhmG Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0388
Name: rhmA Funciton: alpha-L-rhamnosidase
Locus tag: Chy400_0387
Name: GH1 Funciton: glycoside hydrolase family 1 |
||||
rhmE-rhmF-rhmG-rhmA-GH1 | -177 | 5.7 | CATACCGATCGATGCCCAGG | Chy400_0391 |