Orthologous regulated operons containing AAur_0716 gene
| Regulog: | AAur_3503 - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Arthrobacter sp. FB24 | ||||
|
Position: -162
Score: 7.00979 Sequence: CTTTGGAATCGATTCCACAG
Position: -117
Score: 7.00031 Sequence: TTTTGGAATCGATTCCAAAA
Locus tag: Arth_3687
Name: AAur_3501 Funciton: Putative sugar ABC transporter, solute-binding domain protein
Locus tag: Arth_3686
Name: Aaur_3500 Funciton: Putative sugar ABC transporter, permease protein
Locus tag: Arth_3685
Name: Aaur_3499 Funciton: Putative sugar ABC transporter, permease component
Locus tag: Arth_3684
Name: AAur_3498 Funciton: putative sugar oxidoreductase
Locus tag: Arth_3683
Name: thuA Funciton: Trehalose utilization protein
Locus tag: Arth_3682
Name: null Funciton: oxidoreductase domain protein |
||||
| AAur_3501-Aaur_3500-Aaur_3499-AAur_3498-thuA-Arth_3682 | -162 | 7 | CTTTGGAATCGATTCCACAG | Arth_3687 |
| -117 | 7 | TTTTGGAATCGATTCCAAAA | ||