Orthologous regulated operons containing PF02627 gene
| Regulog: | Rmet_4647 - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia eutropha JMP134 | ||||
|
Position: -66
Score: 6.40983 Sequence: ATCTGAAAACGTTTTCCGAA
Locus tag: Reut_A1197
Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor
Locus tag: Reut_A1196
Name: PF00501 Funciton: AMP-dependent synthetase and ligase
Locus tag: Reut_A1195
Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase
Locus tag: Reut_A1194
Name: COG0372 Funciton: Predicted citrate synthase
Locus tag: Reut_A1193
Name: PF02627 Funciton: Putative decarboxylase
Locus tag: Reut_A1192
Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase
Locus tag: Reut_A1191
Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor |
||||
| Rmet_4645-PF00501-Rmet_4646-COG0372-PF02627-Rmet_4646-Rmet_4645 | -66 | 6.4 | ATCTGAAAACGTTTTCCGAA | Reut_A1197 |
| Ralstonia metallidurans CH34 | ||||
|
Position: 54
Score: 5.68065 Sequence: CACGGAAAACGATTCCACAT
Locus tag: Rmet_4646
Name: Rmet_4646 Funciton: Probable short-chain dehydrogenase
Locus tag: Rmet_4645
Name: Rmet_4645 Funciton: Putative extra-cytoplasmic solute receptor
Locus tag: Rmet_4644
Name: PF02627 Funciton: Putative decarboxylase |
||||
| Rmet_4646-Rmet_4645-PF02627 | 54 | 5.7 | CACGGAAAACGATTCCACAT | Rmet_4646 |