Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing GHTCC_010100010863 gene

Properties
Regulog: ScrR - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -75
Score: 5.93154
Sequence: ACCCTTAATCGATTAAGTTT
Locus tag: GHTCC_010100010863
Name: GHTCC_010100010863
Funciton: putative sugar transport protein
Locus tag: GHTCC_010100010858
Name: ogl
Funciton: putative oligo-1,6-glucosidase
GHTCC_010100010863-ogl -75 5.9 ACCCTTAATCGATTAAGTTT GHTCC_010100010863
© 2009-2020 RegPrecise