Orthologous regulated operons containing omp(Scr)2 gene
| Regulog: | ScrR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Glaciecola sp. HTCC2999 | ||||
|
Position: -109
Score: 5.95177 Sequence: TTACTTAATCAATTAAGAAA
Locus tag: GHTCC_010100001240
Name: omp(Scr)2 Funciton: Predicted sucrose-specific TonB-dependent receptor
Locus tag: GHTCC_010100001235
Name: trpH2 Funciton: tryptophan halogenase
Locus tag: GHTCC_010100001230
Name: trpH Funciton: tryptophan halogenase
Locus tag: GHTCC_010100001225
Name: null Funciton: metallo-beta-lactamase family protein |
||||
| omp(Scr)2-trpH2-trpH-GHTCC_010100001225 | -109 | 6 | TTACTTAATCAATTAAGAAA | GHTCC_010100001240 |