Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing trpH2 gene

Properties
Regulog: ScrR - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -109
Score: 5.95177
Sequence: TTACTTAATCAATTAAGAAA
Locus tag: GHTCC_010100001240
Name: omp(Scr)2
Funciton: Predicted sucrose-specific TonB-dependent receptor
Locus tag: GHTCC_010100001235
Name: trpH2
Funciton: tryptophan halogenase
Locus tag: GHTCC_010100001230
Name: trpH
Funciton: tryptophan halogenase
Locus tag: GHTCC_010100001225
Name: null
Funciton: metallo-beta-lactamase family protein
omp(Scr)2-trpH2-trpH-GHTCC_010100001225 -109 6 TTACTTAATCAATTAAGAAA GHTCC_010100001240
© 2009-2020 RegPrecise