Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ATW7_17172 gene

Properties
Regulog: ScrR - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -97
Score: 6.56292
Sequence: AATCTTAATCGTTTAAGTTT
Locus tag: GHTCC_010100000760
Name: null
Funciton: Alpha-glucosidase
Locus tag: GHTCC_010100000755
Name: null
Funciton: putative ATP synthase F0, A subunit
GHTCC_010100000760-GHTCC_010100000755 -97 6.6 AATCTTAATCGTTTAAGTTT GHTCC_010100000760
© 2009-2020 RegPrecise