Orthologous regulated operons containing scrR gene
Regulog: | ScrR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sucrose utilization |
Effector: | Sucrose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Alteromonas macleodii 'Deep ecotype' | ||||
Position: -108
Score: 5.80045 Sequence: TAAGTTAAACGTTTAAGATA
Locus tag: MADE_02629
Name: scrR Funciton: Transcriptional regulator for sucrose utilization, LacI family |
||||
scrR | -108 | 5.8 | TAAGTTAAACGTTTAAGATA | MADE_02629 |
Glaciecola sp. HTCC2999 | ||||
Position: -81
Score: 5.94409 Sequence: TCGCTTAATCGATTAAGTTT
Locus tag: GHTCC_010100004760
Name: scrR Funciton: Transcriptional regulator for sucrose utilization, LacI family |
||||
scrR | -81 | 5.9 | TCGCTTAATCGATTAAGTTT | GHTCC_010100004760 |
Pseudoalteromonas atlantica T6c | ||||
Position: -377
Score: 6.29075 Sequence: CATCTTAAACGTTTAAGATT
Locus tag: Patl_3821
Name: scrR Funciton: Transcriptional regulator for sucrose utilization, LacI family |
||||
scrR | -377 | 6.3 | CATCTTAAACGTTTAAGATT | Patl_3821 |